online ice analysis tool by synthego (Synthego Inc)

About

News

Press Release

Team

Advisors

Partners

Contact

Bioz Stars

Bioz vStars

Buy from Supplier

Structured Review

Synthego Inc online ice analysis tool by synthego

A : Bar graph showing <t>ICE</t> analysis results of targeting of SMAD4, B2M, KDM6A and TP53 in pKDNFs using Cas9 VLPs. Blue bars: INDEL scores, green bars: KO scores compared to WT control (n≥3; SD shown). B : Bar graph showing ICE analysis results of targeting of IL-10 in developed blastocysts (B1-B6) using multiplexed Cas9 VLPs. Blue bars: INDEL scores, green bars: KO scores compared to WT control. C : <t>Detected</t> <t>INDELs</t> of blastocyst 2 (B2) report that in 98% of the cases, the whole fragment was deleted.

Online Ice Analysis Tool By Synthego, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/ice+online+tool/analysis+crispr+ice+tool/bio_rxiv__64898__2026__03__30__715406-195-11-16
Average 86 stars, based on 1 article reviews

online ice analysis tool by synthego - by Bioz Stars, 2026-09

86/100 stars

Images

1) Product Images from "Virus-Like Particles: The Next Frontier in Livestock Gene Editing"

Article Title: Virus-Like Particles: The Next Frontier in Livestock Gene Editing

Journal: bioRxiv

doi: 10.64898/2026.03.30.715406

A : Bar graph showing ICE analysis results of targeting of SMAD4, B2M, KDM6A and TP53 in pKDNFs using Cas9 VLPs. Blue bars: INDEL scores, green bars: KO scores compared to WT control (n≥3; SD shown). B : Bar graph showing ICE analysis results of targeting of IL-10 in developed blastocysts (B1-B6) using multiplexed Cas9 VLPs. Blue bars: INDEL scores, green bars: KO scores compared to WT control. C : Detected INDELs of blastocyst 2 (B2) report that in 98% of the cases, the whole fragment was deleted.

Figure Legend Snippet: A : Bar graph showing ICE analysis results of targeting of SMAD4, B2M, KDM6A and TP53 in pKDNFs using Cas9 VLPs. Blue bars: INDEL scores, green bars: KO scores compared to WT control (n≥3; SD shown). B : Bar graph showing ICE analysis results of targeting of IL-10 in developed blastocysts (B1-B6) using multiplexed Cas9 VLPs. Blue bars: INDEL scores, green bars: KO scores compared to WT control. C : Detected INDELs of blastocyst 2 (B2) report that in 98% of the cases, the whole fragment was deleted.

Techniques Used: Control

Knock-Out:

Article Title: Enhancing tolerance to Phytophthora spp. in eggplant through DMR6-1 CRISPR/Cas9 knockout
Article Snippet: PCR amplification was performed using KAPA HIFI Taq (Kapa Biosystems, Boston, USA) with the following PCR program: 1 cycle of 95 ◦C for 3 min; 30 cycles of 98 ◦C for 20 s, 63 ◦C for 15 s, 72 ◦C for 45 s; 1 cycle of 72 ◦C for 1 min. After purification with AMPure XP Beads 0.8X (Beckman Coulter), amplicons were sequenced by Sanger method. .. The knock-out score and indels were estimated by analysing the chromatograms using the Synthego ICE online tool (https: //ice.synthego.com/). .. The screening for hCas9 presence was performed through real-time PCR using a StepOnePlus Real-Time PCR system (Applied Biosystem), with technical duplicates.

Clone Assay:

Article Title: CRISPR/Cas9-mediated knock out of ITGB6 in human OSCC cells reduced migration and proliferation ability.
Article Snippet: .. In total, four clones were identified as potential KOs of ITGB6 by analysis with the ICE online tool (Synthego, Redwood City, USA; https://ice.synthego.com). ..

Article Title: CRISPR/Cas9-mediated knock out of ITGB6 in human OSCC cells reduced migration and proliferation ability
Article Snippet: .. In total, four clones were identified as potential KOs of ITGB6 by analysis with the ICE online tool (Synthego, Redwood City, USA; https://ice.synthego.com ). ..

other:

Article Title: MUC2 Expression Modulates Immune Infiltration in Colorectal Cancer
Article Snippet: Synthego ICE https://ice.synthego.com/#/ [6] online tool was used to analyze the indels in bulk and for each individual clones (after sort described below).

Polymerase Chain Reaction:

Article Title: iPSC-derived human liver organoids uncover ductular reaction as a hallmark of Wolman disease and inform gene therapy design
Article Snippet: The genomic DNA was extracted from iPSCs and hICOs using NucleoSpin® Tissue kit (Macherey-Nagel 740952) following manufacturer protocol. .. PCR products spanning the edited site were obtained using PCR primer pair FW (5’TGGTCCAGTTTCACTGCTACCTT3’) – RV (5’AATAACGTTTACCCAGCAGCAC3’), Sanger sequenced and analyzed with ICE online tool (Synthego). .. Human iPSCs were homogenized in PBS containing 0.5% Triton X-100 and a protease inhibitor cocktail (Roche), followed by centrifugation at 13,000 × g for 10 min at 4 °C.

Sequencing:

Article Title: CC2D1A causes ciliopathy, intellectual disability, heterotaxy, renal dysplasia, and abnormal CSF flow.
Article Snippet: The PCR products were run on an agarose gel; the fragments were gelextracted and purified using Monarch DNA Gel Extraction Kit (#T1020S; NEB), then sent for Sanger sequencing (Quintarabio). .. Sequencing results were then analyzed for cutting efficiency using the Synthego ICE online tool. ..

Review